apple7
apple7 apple7
  • 04-03-2016
  • Mathematics
contestada

how can u write 20 over 10 as a mixed number

Respuesta :

Аноним Аноним
  • 08-03-2016
you can write 20/10 as a mixed number by dividing 20 by 10 and you 2 as your answer.

So, Your answer will be 2.

Hope that helped.
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the table shows the elevation of 6 cities in CaliforniaCity                                                               ElevationWestmorland
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
who was the founder of Pennsylvania?
Write expression using the distributive property to find the product of 7 times 63
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!