sophiarose8209 sophiarose8209

02-09-2019
History

contestada

Why didn’t England make stronger attempts to colonize the New World before the late sixteenth to early seventeenth century?

Respuesta :

brysontimmy brysontimmy

02-09-2019

Answer:

English attention was turned to internal struggles and the encroaching Catholic menace to Scotland and Ireland.

Answer Link

Otras preguntas

A hexahedron is a prism whose base is a _____. A. equilateral triangle B. square C. circle D. triangle

punctuated equilibrium definition biology

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Secured it means a lender gives you money in exchange for what?

Mrs. smith underwent an arthrodesis of her spine for spinal deformity, posterior approach, segments l3-l5. what procedure code is reported

what are the zeros of the function? f(x)=+-6x

Find f(x) if it is known that f(x−2)=2x−4.

The 1954 supreme court case that ruled racially segregated school systems "inherently unequal" was

What is the difference between a settler an an explorer social studies?

I'm not sure how to do this I was not there that day they taught this and idk what some are and it was yesterday so..