peachonefive1 peachonefive1
  • 02-11-2020
  • English
contestada

What phrase signals a cause and effect relationship

Respuesta :

lairdelijah8
lairdelijah8 lairdelijah8
  • 02-11-2020

Answer:

like "so, because, and, then, thus"

Answer Link

Otras preguntas

Find the slope (-8, 18) and (-14, -3)
Jill converted the equation of the line 15 x minus 14 y = negative 2 into slope-intercept form and found the slope and y-intercept of the line as follows. 15 x
negative 8/9 divided by 2/3
Joseph drives 125 miles in 2.5 hours. At the same rate, how far will he be able to travel in 6 hours?
If Fernando paid $450 for a netbook that was 75% of the original price, what was the original price?
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
During a telephone conference call, Rafaela asks her assistant to complete a report as soon as possible that day. The assistant, however, didn’t understand the
determine the molarity of a solution that has 0.267 mol of solute dissolved in 2.25 Liters of solution
A 300 mm long steel bar with a square cross section (25 mm per edge) is pulled in tension with a load of 84998 N , and experiences an axial elongation of 0.18 m
What impact does the setting have on Vinny?