jamar990 jamar990

02-02-2021
Spanish

contestada

Lisa tiene cinco camisas y Ana tiene cinco camisas

Respuesta :

Аноним Аноним

02-02-2021

Answer:

Translates to : Lisa has five shirts and Ana has five shirts.

Explanation:

Answer Link

luluc532 luluc532

02-02-2021

Answer:

Lisa has five shirts and Ana has five shirts

Explanation:

Hope this Helped! :)

Answer Link

Otras preguntas

Does the increase in blood glucose levels increase the viscosity of the blood

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Let f(x) = x+7 and g(x) = x-4 Find f(x) times g(x)

The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side

One of the most damaging problems of the carter administration was its failure to win the release of u.s. hostages from

What was one of the two major goals that the national organization for women work towards when it was first founded?

HR contains six red chili beans for green jellybeans and four blue jelly beans if we choose a jellybean then another jellybean without putting the first time ba

Why is the epa considered to be one of the most powerful bureaucracies?

What is the area of this composed figure

A student is conducting an experiment to determine how far a ball will roll down a ramp based on the angle of incline. What are the independent and dependent