samueladesanya906 samueladesanya906
  • 04-08-2021
  • Mathematics
contestada

the area of an equilateral triangle of side 8cm is
pls i need answer ASAP
I'll mark brainliest for anyone who can help me​

Respuesta :

Аноним Аноним
  • 04-08-2021
  • Side=a=8cm

[tex]\\ \sf\longmapsto Area=\dfrac{\sqrt{3}}{4}a^2[/tex]

[tex]\\ \sf\longmapsto Area=\dfrac{\sqrt{3}}{4}(8)^2[/tex]

[tex]\\ \sf\longmapsto Area=\dfrac{64\sqrt{3}}{4}[/tex]

[tex]\\ \sf\longmapsto Area=16\sqrt{3}[/tex]

[tex]\\ \sf\longmapsto Area=16\times 1.732[/tex]

[tex]\\ \sf\longmapsto Area=27.7cm^2[/tex]

Answer Link

Otras preguntas

Who is largely responsible for the spread of hellenistic culture in the 4th century bc?
Find the probability that 4 students chosen at random are all born on a Wednesday. A) 1/28 B) 1/2401 C) 4/2401 D) 1/254
Decide if the following command is grammatically correct or incorrect. (tu) no digo mentiras.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Please help me with this
Ully is having a party and wants to fill his swimming pool. if he only uses his hose it takes 2 hours more than if he only uses his neighbor's house. of houses
Which phrase best describes the New World Order?
describe how the resistance of the filament lamp changes as the current through it increases.
please answer this im dying here
It is illegal for a minor to even attempt to purchase alcohol. a. True b. False