gsmheah16 gsmheah16

03-09-2021
Mathematics

contestada

name of the vertex of <4 name the side of <1 write another name <5 classify each angle

Respuesta :

BABYPLUT0 BABYPLUT0

03-09-2021

Answer:

A. vertex B

B. Side BC and BD

C. Angle EBD

Step-by-step explanation:

Me and my Teacher did this together

Answer Link

Otras preguntas

Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s

What type of plot structure allows authors to follow different characters through their own separate narratives, eventually converging, as the story is resolved

Why do you think it is a good idea to soak wilted lettuce in cool water before serving it?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is one key difference between the radiation and convection zones?

Which great society program was a comprehensive health insurance program for all senior citizens?

why are the hindlimbs important on the frog

What was OPEC protesting when it imposed it's embargo?

Characteristics of the early u.s. navy "super frigates" included ______________. select all that apply.

Explain the significance of the phoenix. what, according to granger, makes humans different from the phoenix?