judybline7 judybline7

02-12-2021
Mathematics

contestada

Mows 3/8 of lawn & uses3/4gal of gas. What fraction of lawn can be mowed per gallon

Respuesta :

TristanBalliente TristanBalliente

02-12-2021

Answer:

1/8 of the lawn can be mowed per gallon.

Answer Link

Otras preguntas

Hello everyone, I need help on this Math question (:

Instrucciones: Escribe la conjugacion correcta de los verbos irregulares

830 women and 170 men attended a real estate conference. What percentage of the people at the conference were women? Write your answer using a percent sign (%)

BRAINLIST FOR RIGHT ANSWER! Which of the following are domain restrictions for the expression 3-1)(x+3). There may be more than one. (x+2)(x-1 a. x = 3 b. x = 1

Imagine you are a passenger in a car and you are looking out the window. A car is in the lane next to you facing the same direction, but they are behind your ca

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

what is a/3+4=6? I can't figure it out!

the functionalist perspective argues that deviance

Read the bullet points, then answer the question. Power is concentrated in the national government. Regional governments exist to implement the policies of the

A company that makes hair-care products had 5,000 people try a new shampoo. Of the 5,000 people, 10 had a mild allergic reaction. What percent of the people h