MilleeM397942 MilleeM397942
  • 03-11-2022
  • Chemistry
contestada

In the equation aCH4 + bO2 → cCO2 + dH2O, which of the following corresponds to a, b, c, and d, respectively, to make the equation balanced?.

In the equation aCH4 bO2 cCO2 dH2O which of the following corresponds to a b c and d respectively to make the equation balanced class=

Respuesta :

ArloR103514 ArloR103514
  • 03-11-2022
[tex]CH_4+2O_2\rightarrow CO_2+2H_2O[/tex]

Answer: 1,2,1,2

Answer Link

Otras preguntas

What is the sum of 6/10 plus 7/12
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
31+34=90-n 45+1=70-k 6×9=41+m
How do I do trebuchet calculations????? Help me please
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is the most common type of vegetation throughout Latin America
How many times does four go into 153 ? What Is the remainder ?
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?