JoeF111343 JoeF111343
  • 04-11-2022
  • Mathematics
contestada

Find the volume of a HEMIsphere with a radius of 4.

Respuesta :

SeamusZ772454 SeamusZ772454
  • 04-11-2022

ANSWER

[tex]134.04\text{ cubic units}[/tex]

EXPLANATION

The volume of a hemisphere is given by:

[tex]V=\frac{2}{3}\pi r^3[/tex]

where r = radius

Hence, the volume of the given hemisphere is:

[tex]\begin{gathered} V=\frac{2}{3}*\pi *4^3 \\ V=134.04\text{ cubic units} \end{gathered}[/tex]

That is the answer.

Answer Link

Otras preguntas

What is the purpose of plasmid technology
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Which expressions are equivalent to -6+4q+(-6q)? Choose all answers that apply: (Choice A) A -6(q+1)-4q (Choice B) B 2(q-3) (Choice C) C None of the above Brain
Behaviors are diverse and important for survival and reproduction. Some behaviors are learned, such as the species-specific song of a yellow warbler which is di
z varies directly with x and inversly with y^2 what is the value of z when x=4 and y=9
Mulherin's stock has a beta of 1.2, its required return is 10%, and the risk-free rate is 4%. What is the required rate of return on the market? (Answer: %, Hin
9. Simplify 1-3 - 81.
Why did traditional military methods of movement and maneuvering not work?
List five requirements for a healthful Environment.
what is medicare and medicade and why is it important