haloman55 haloman55
  • 02-05-2017
  • English
contestada

what does the story of Anne Frank mean to you?

Respuesta :

alexhunter65 alexhunter65
  • 02-05-2017
it means the struggles of how jewish peoole were treated and abused
Answer Link

Otras preguntas

A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
what was paul revere failures
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
What are the factors of 6x + 24?